20% OFF shipping at www.randa.lt on orders over $79 + up to 10% OFF products
www.randa.lt
home > CD140a Recombinant Protein - NCP0265 > CD140a Recombinant Protein - NCP0265
download picture
CD140a Recombinant Protein - NCP0265CD140a Recombinant Protein Catalogue Number: NCP0265 500, NCP0265 1000 Sizes: 500ug, 1mg Swiss Prot: P16234 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD140a Recombinant Protein

Catalogue Number: NCP0265-500, NCP0265-1000

Sizes: 500ug, 1mg

Swiss-Prot: P16234

Host: E.coli

Tag: His-tag

AA Sequence: CAGCTGAGCCTGCCGAGTATTCTGCCGAATGAAAATGAAAAAGTTGTTCAGCTGAACAGTAGCTTCAGTCTGCGCTGCTTCGGTGAAAGCGAAGTTAGTTGGCAGTATCCGATGAGTGAAGAAGAAAGCAGCGATGTTGAAATTCGCAATGAAGAAAATAACAGCGGCCTGTTCGTTACCGTGCTGGAAGTGAGTAGTGCAAGTGCCGCACATACCGGTCTGTATACCTGCTATTATAATCATACCCAGACCGAAGAAAATGAACTGGAAGGTCGCCATATCTATATCTATGTTCCGGATCCGGATGTGGCATTCGTGCCGCTGGGTATGACCGATTATCTGGTTATTGTGGAAGATGATGATAGCGCAATTATTCCGTGCCGTACCACCGATCCGGAAACACCTGTTACCCTGCATAATAGTGAAGGTGTTGTTCCGGCCAGCTATGATAGTCGTCAGGGCTTCAATGGCACCTTCACCGTTGGCCCGTATATCTGTGAAGCAACCGTGAAAGGTAAAAAATTCCAGACCATTCCGTTCAATGTGTATGCCCTGAAAGCCACCAGTGAACTGGATCTGGAAATGGAAGCACTGAAAACCGTGTATAAAAGTGGCGAAACCATTGTTGTTACCTGCGCCGTGTTCAATAATGAAGTGGTGGATCTGCAGTGGACCTATCCGGGCGAAGTGAAAGGTAAGGGTATTACCATGCTGGAAGAAATTAAAGTGCCGAGCATTAAACTGGTGTATACCCTGACCGTTCCGGAAGCCACCGTTAAAGATAGTGGTGATTATGAATGTGCAGCACGTCAGGCCACCCGCGAAGTTAAAGAAATGAAAAAAGTGACCATCAGTGTTCATGAAAAAGGCTTCATTGAAATTAAGCCGACCTTCAGTCAGCTGGAAGCCGTTAATCTGCATGAAGTTAAACACTTCGTTGTGGAAGTTCGTGCATATCCGCCGCCGCGCATTAGCTGGCTGAAAAATAATCTGACCCTGATTGAAAATCTGACCGAAATTACCACCGATGTTGAAAAAATTCAGGAAATTCGTTACCGTAGTAAACTGAAACTGATTCGCGCCAAAGAAGAAGATAGCGGTCATTATACCATTGTTGCCCAGAATGAAGATGCCGTTAAAAGCTATACCTTCGAACTGCTGACCCAGGTGCCGAGCAGTATTCTGGATCTGGTGGATGATCATCATGGTAGCACCGGTGGCCAGACCGTTCGCTGTACCGCAGAAGGCACCCCGCTGCCGGATATTGAATGGATGATCTGTAAAGATATCAAGAAATGTAACAACGAGACCAGTTGGACCATTCTGGCCAATAATGTGAGTAATATTATCACCGAAATCCATAGTCGTGATCGTAGTACCGTTGAAGGTCGCGTTACCTTCGCAAAAGTGGAAGAAACCATTGCCGTGCGTTGCCTGGCCAAAAATCTGCTGGGCGCAGAAAATCGTGAACTGAAACTGGTTGCACCGACCCTGCGCAGCGAACTGACCGTTGCC

Restriction Sites: NdeI-XhoI

Background: Platelet derived growth factor (PDGF) family proteins exist as several disulphide-bonded, dimeric isoforms (PDGF AA, PDGF AB, PDGF BB, PDGF CC, and PDGF DD) that bind in a specific pattern to two closely related receptor tyrosine kinases, PDGF receptor α (PDGFRα) and PDGF receptor β (PDGFRβ). PDGFRα and PDGFRβ share 75% to 85% sequence homology between their two intracellular kinase domains, while the kinase insert and carboxy-terminal tail regions display a lower level (27% to 28%) of homology. PDGFRα homodimers bind all PDGF isoforms except those containing PDGF D. PDGFRβ homodimers bind PDGF BB and DD isoforms, as well as the PDGF AB heterodimer. The heteromeric PDGF receptor α/β binds PDGF B, C, and D homodimers, as well as the PDGF AB heterodimer. PDGFRα and PDGFRβ can each form heterodimers with EGFR, which is also activated by PDGF. Various cells differ in the total number of receptors present and in the receptor subunit composition, which may account for responsive differences among cell types to PDGF binding. Ligand binding induces receptor dimerization and autophosphorylation, followed by binding and activation of cytoplasmic SH2 domain-containing signal transduction molecules, such as GRB2, Src, GAP, PI3 kinase, PLCγ, and NCK. A number of different signaling pathways are initiated by activated PDGF receptors and lead to control of cell growth, actin reorganization, migration, and differentiation. Tyr751 in the kinase-insert region of PDGFRβ is the docking site for PI3 kinase. Phosphorylated pentapeptides derived from Tyr751 of PDGFRβ (pTyr751-Val-Pro-Met-Leu) inhibit the association of the carboxy-terminal SH2 domain of the p85 subunit of PI3 kinase with PDGFR. Tyr740 is also required for PDGFRβ-mediated PI3 kinase activation.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~66kDa

Notes: For research use only, not for use in diagnostic procedure.

CD140a Recombinant Protein - NCP0265

Item no : 19507167150
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches