CD137 Recombinant Protein

Catalogue Number: NCP0263-500, NCP0263-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q07011

Host: E.coli

Tag: His-tag

AA Sequence: CTGCAGGATCCGTGTAGCAATTGCCCGGCAGGTACCTTCTGTGATAATAATCGCAATCAGATCTGTAGCCCGTGTCCGCCGAATAGCTTCAGTAGCGCCGGCGGTCAGCGCACCTGTGATATCTGTCGCCAGTGTAAAGGCGTGTTCCGTACCCGTAAAGAATGCAGCAGCACCAGTAATGCCGAATGTGATTGTACCCCGGGCTTCCATTGCCTGGGCGCAGGTTGTAGCATGTGTGAACAGGATTGCAAACAGGGTCAGGAACTGACCAAAAAAGGCTGTAAAGATTGCTGCTTCGGTACCTTCAATGATCAGAAACGCGGTATCTGTCGTCCGTGGACCAATTGCAGCCTGGATGGCAAAAGTGTTCTGGTTAATGGTACCAAAGAACGTGATGTTGTGTGCGGTCCGAGTCCGGCAGATCTGAGCCCGGGCGCAAGCAGTGTGACCCCGCCTGCTCCGGCACGTGAACCGGGTCATAGTCCGCAG

Restriction Sites: NdeI-XhoI

Background: TNFRSF9 is a member of the tumor necrosis factor receptor superfamily. It is also called 4-1BB or CD137. 4-1BB/CD137/TNFRSF9 is expressed in activated CD4+ and CD8+ T cells, natural killer cells and dendritic cells. The ligand 4-1BBL/CD137L/TNFSF9 on antigen presenting cells binds to 4-1BB/CD137/TNFRSF9 and costimulates the activation of T cells. The binding of agonistic antibodies to 4-1BB/CD137/TNFRSF9 also leads to costimulation for T cell activation. Studies have shown the effectiveness of targeting 4-1BB/CD137/TNFRSF9 by its agonistic antibodies in cancer immunotherapy.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~24kDa

Notes: For research use only, not for use in diagnostic procedure.