CD37 Recombinant Protein

Catalogue Number: NCP0203-500, NCP0203-1000

Sizes: 500ug, 1mg

Swiss-Prot: P11049

Host: E.coli

Tag: His-tag

AA Sequence: CGTGCACAGCTGGAACGCAGTCTGCGCGATGTTGTTGAAAAAACCATTCAGAAATACGGTACCAATCCGGAAGAAACCGCAGCAGAAGAAAGCTGGGATTATGTTCAGTTCCAGCTGCGTTGTTGCGGTTGGCATTATCCGCAGGATTGGTTCCAGGTTCTGATTCTGCGCGGTAATGGTAGCGAAGCACATCGTGTTCCGTGCAGTTGTTATAATCTGAGTGCCACCAATGATAGTACCATTCTGGATAAAGTGATTCTGCCGCAGCTGAGCCGTCTGGGCCATCTGGCACGTAGTCGCCATAGCGCAGATATCTGTGCAGTGCCGGCCGAAAGTCATATCTATCGCGAAGGCTGTGCACAGGGCCTGCAGAAATGGCTGCATAATAAT

Restriction Sites: NdeI-XhoI

Background: Tetra-spans transmembrane family (TSTF) members (CD9, CD37, CD53, CD63, CD81 and CD82) are cell-surface proteins that are characterized by the presence of four hydrophobic, membrane-spanning domains. TSTF members can mediate signal transduction events influencing the regulation of cell development, adhesion, activation, growth and motility. The human CD37 gene maps to chromosome 19p13.3 and encodes a 281 amino acid protein. CD37 is a cell surface glycoprotein that can complex with integrins and other TSTF proteins and may play a role in T cell-B cell interactions. CD37 is strongly expressed on normal and neoplastic mature sIg+ B cells and is detected at low levels on resting and activated T cells, neutrophils, granulocytes and monocytes. Transgenic mouse models elicit no changes in development and cellular composition of lymphoid organs where CD37 is lacking.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~16kDa

Notes: For research use only, not for use in diagnostic procedure.