20% OFF shipping at www.randa.lt on orders over $79 + up to 10% OFF products
www.randa.lt
home > CD66/CEACAM1 Recombinant Protein - NCP0220 > CD66/CEACAM1 Recombinant Protein - NCP0220
download picture
CD66/CEACAM1 Recombinant Protein - NCP0220CD66 CEACAM1 Recombinant Protein Catalogue Number: NCP0220 500, NCP0220 1000 Sizes: 500ug, 1mg Swiss Prot: P13688 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD66/CEACAM1 Recombinant Protein

Catalogue Number: NCP0220-500, NCP0220-1000

Sizes: 500ug, 1mg

Swiss-Prot: P13688

Host: E.coli

Tag: His-tag

AA Sequence: CAGCTGACCACCGAAAGCATGCCGTTCAATGTGGCCGAAGGCAAAGAAGTTCTGCTGCTGGTTCATAATCTGCCGCAGCAGCTGTTCGGTTATAGTTGGTATAAAGGTGAACGCGTGGATGGTAATCGCCAGATTGTGGGTTATGCCATTGGTACCCAGCAGGCAACCCCGGGTCCGGCTAATAGTGGCCGCGAAACCATCTATCCGAATGCCAGCCTGCTGATTCAGAATGTTACCCAGAATGATACCGGCTTCTATACCCTGCAGGTGATTAAAAGTGATCTGGTTAATGAAGAAGCCACCGGTCAGTTCCATGTGTATCCGGAACTGCCGAAACCGAGCATTAGTAGCAATAATAGTAATCCGGTGGAAGATAAAGATGCAGTTGCCTTCACCTGTGAACCGGAAACACAAGATACCACCTATCTGTGGTGGATTAATAATCAGAGTCTGCCGGTTAGCCCGCGCCTGCAGCTGAGCAATGGTAATCGCACCCTGACCCTGCTGAGCGTTACCCGTAATGATACCGGTCCGTATGAATGCGAAATTCAGAATCCGGTTAGCGCAAATCGCAGCGATCCGGTTACCCTGAATGTTACCTATGGCCCGGATACCCCGACCATTAGTCCGAGCGATACCTATTATCGTCCGGGTGCAAATCTGAGTCTGAGCTGCTATGCAGCAAGCAATCCGCCGGCACAGTATAGCTGGCTGATTAATGGCACCTTCCAGCAGAGTACCCAGGAACTGTTCATTCCGAATATTACCGTTAATAATAGCGGTAGCTATACCTGTCATGCAAATAATAGTGTTACCGGTTGCAATCGTACCACCGTTAAAACCATTATTGTGACCGAACTGAGCCCGGTGGTTGCCAAACCGCAGATTAAAGCAAGTAAAACCACCGTTACCGGCGATAAAGATAGCGTTAATCTGACCTGTAGTACCAATGATACCGGAATTAGCATTCGTTGGTTCTTCAAAAATCAGAGCCTGCCGAGTAGCGAACGCATGAAACTGAGCCAGGGCAATACCACCCTGAGTATTAATCCGGTGAAACGTGAAGATGCCGGCACCTATTGGTGCGAAGTGTTCAATCCGATTAGTAAAAATCAGTCAGATCCGATTATGCTGAATGTTAATTATAACGCCCTGCCGCAGGAAAATGGTCTGAGCCCGGGC

Restriction Sites: NdeI-XhoI

Background: CEACAM1 (also known as C-CAM and CD66a) is a member of CEA-related cell-adhesion molecule (CEACAM) subfamily of the carcinoembryonic antigen (CEA) family. CEACAM1 is expressed by certain epithelial, endothelial, lymphoid, and myeloid cells. Human CEACAM1 has many different splice variants; the abundance of CEACAM1 and the relative ratio of the different isoforms varies markedly among cell types and may be regulated in a context-dependent fashion. The isoforms with long (L) and short (S) cytoplasmic tails have different signaling properties. Notably, L isoforms contain a functional ITIM (immunoreceptor tyrosine-based inhibitory motif) and several serine and threonine residues that could serve as potential phosphorylation targets. The extracellular domain of CEACAM1 is heavily glycosylated, making its apparent molecular weight during electrophoresis much larger than its predicted size (57.6 kDa). CEACAM1 mediates intercellular adhesion through homo- and heterophilic interaction with other members of the CEACAM family. Studies indicate that CEACAM1 plays important roles in angiogenesis, neovascularization, insulin signaling, T cell signaling, and tumorigenesis. In addition, CEACAM1 can function as a receptor for several microbial pathogens.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~45kDa

Notes: For research use only, not for use in diagnostic procedure.

CD66/CEACAM1 Recombinant Protein - NCP0220

Item no : 8520959412
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches