20% OFF shipping at www.randa.lt on orders over $79 + up to 10% OFF products
www.randa.lt
home > CD144 Recombinant Protein - NCP0269 > CD144 Recombinant Protein - NCP0269
download picture
CD144 Recombinant Protein - NCP0269CD144 Recombinant Protein Catalogue Number: NCP0269 500, NCP0269 1000 Sizes: 500ug, 1mg Swiss Prot: P33151 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD144 Recombinant Protein

Catalogue Number: NCP0269-500, NCP0269-1000

Sizes: 500ug, 1mg

Swiss-Prot: P33151

Host: E.coli

Tag: His-tag

AA Sequence: GATTGGATCTGGAATCAGATGCATATTGATGAAGAAAAAAACACCAGTCTGCCGCATCATGTGGGTAAAATTAAAAGCAGTGTGAGCCGCAAAAATGCAAAATATCTGCTGAAAGGTGAATATGTGGGTAAAGTGTTCCGCGTTGATGCAGAAACCGGTGATGTGTTCGCAATTGAACGTCTGGATCGTGAAAATATTAGTGAATATCATCTGACCGCAGTGATTGTTGATAAAGATACCGGTGAAAATCTGGAAACACCTAGTAGCTTCACCATTAAAGTGCATGATGTGAATGATAATTGGCCGGTGTTCACCCATCGTCTGTTCAATGCAAGCGTTCCGGAAAGTAGCGCCGTGGGTACCAGTGTTATTAGCGTTACCGCCGTTGATGCAGATGATCCGACCGTTGGTGATCATGCAAGTGTTATGTATCAGATTCTGAAAGGCAAAGAATACTTCGCCATTGATAATAGTGGTCGCATTATTACCATTACCAAAAGTCTGGATCGCGAAAAACAGGCCCGCTATGAAATTGTTGTGGAAGCACGTGATGCACAGGGCCTGCGCGGCGATAGTGGTACCGCAACCGTTCTGGTGACCCTGCAGGATATTAATGATAACTTCCCGTTCTTCACCCAGACCAAATATACCTTCGTGGTTCCGGAAGATACCCGCGTGGGCACCAGCGTGGGTAGCCTGTTCGTTGAAGATCCGGATGAACCGCAGAATCGTATGACCAAATATAGTATTCTGCGCGGTGATTATCAGGATGCCTTCACCATTGAAACCAATCCGGCACATAATGAAGGCATTATTAAACCGATGAAACCGCTGGATTATGAATATATTCAGCAGTATAGCTTCATCGTGGAAGCAACCGATCCGACCATTGATCTGCGCTATATGAGTCCGCCGGCCGGTAATCGTGCACAGGTTATTATTAATATTACCGATGTTGACGAGCCGCCGATCTTCCAGCAGCCGTTCTATCACTTCCAGCTGAAAGAAAATCAGAAAAAACCGCTGATTGGCACCGTTCTGGCCATGGATCCGGATGCAGCCCGTCATAGCATTGGTTATAGTATTCGTCGCACCAGCGATAAAGGTCAGTTCTTCCGCGTGACCAAAAAAGGCGATATCTATAATGAAAAGGAGCTGGATCGCGAGGTGTATCCGTGGTATAATCTGACCGTTGAAGCAAAAGAACTGGATAGTACCGGCACCCCGACCGGCAAAGAAAGCATTGTTCAGGTTCATATTGAAGTGCTGGATGAAAATGATAATGCACCGGAATTCGCCAAACCGTATCAGCCGAAAGTGTGTGAAAATGCAGTGCATGGTCAGCTGGTGCTGCAGATTAGCGCCATTGATAAAGATATTACCCCGCGTAATGTGAAATTCAAATTCATTCTGAACACCGAAAACAACTTCACCCTGACCGATAATCATGATAATACCGCAAATATTACCGTGAAATATGGCCAGTTCGATCGCGAACATACCAAAGTTCACTTCCTGCCGGTGGTGATTAGTGATAATGGCATGCCGAGCCGTACCGGCACCAGTACCCTGACCGTTGCCGTGTGCAAATGTAATGAACAGGGTGAATTCACCTTCTGTGAAGATATGGCAGCCCAGGTGGGCGTTAGTATTCAG

Restriction Sites: NdeI-XhoI

Background: Cadherins are a superfamily of transmembrane glycoproteins that contain cadherin repeats of approximately 100 residues in their extracellular domain. Cadherins mediate calcium-dependent cell-cell adhesion and play critical roles in normal tissue development. The classic cadherin subfamily includes N-, P-, R-, B-, and E-cadherins, as well as about ten other members that are found in adherens junctions, a cellular structure near the apical surface of polarized epithelial cells. The cytoplasmic domain of classical cadherins interacts with β-catenin, γ-catenin (also called plakoglobin), and p120 catenin. β-catenin and γ-catenin associate with α-catenin, which links the cadherin-catenin complex to the actin cytoskeleton. While β- and γ-catenin play structural roles in the junctional complex, p120 regulates cadherin adhesive activity and trafficking. Investigators consider E-cadherin an active suppressor of invasion and growth of many epithelial cancers. Research studies indicate that cancer cells have upregulated N-cadherin in addition to loss of E-cadherin. This change in cadherin expression is called the "cadherin switch." N-cadherin cooperates with the FGF receptor, leading to overexpression of MMP-9 and cellular invasion. Research studies have shown that in endothelial cells, VE-cadherin signaling, expression, and localization correlate with vascular permeability and tumor angiogenesis. Investigators have also demonstrated that expression of P-cadherin, which is normally present in epithelial cells, is also altered in ovarian and other human cancers.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~61kDa

Notes: For research use only, not for use in diagnostic procedure.

CD144 Recombinant Protein - NCP0269

Item no : 18945672405
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches