20% OFF shipping at www.randa.lt on orders over $79 + up to 10% OFF products
www.randa.lt
home > CD352 Recombinant Protein - NCP0302 > CD352 Recombinant Protein - NCP0302
download picture
CD352 Recombinant Protein - NCP0302CD352 Recombinant Protein Catalogue Number: NCP0302 500, NCP0302 1000 Sizes: 500ug, 1mg Swiss Prot: Q96DU3 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD352 Recombinant Protein

Catalogue Number: NCP0302-500, NCP0302-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q96DU3

Host: E.coli

Tag: His-tag

AA Sequence: CAGAGTAGTCTGACCCCGCTGATGGTTAATGGTATTCTGGGCGAAAGTGTTACCCTGCCGCTGGAATTCCCGGCAGGCGAAAAAGTTAACTTCATTACCTGGCTGTTCAATGAAACCAGTCTGGCATTCATTGTTCCGCATGAAACCAAAAGTCCGGAAATTCATGTTACCAATCCGAAACAGGGCAAACGCCTGAACTTCACCCAGAGTTATAGCCTGCAGCTGAGTAATCTGAAAATGGAAGATACCGGTAGTTATCGTGCCCAGATTAGTACCAAAACCAGTGCAAAACTGAGCAGCTATACCCTGCGCATTCTGCGCCAGCTGCGTAATATTCAGGTGACCAATCATAGCCAGCTGTTCCAGAATATGACCTGTGAACTGCATCTGACCTGCAGCGTGGAAGATGCAGATGATAATGTGAGCTTCCGTTGGGAAGCCCTGGGCAATACCCTGAGCAGCCAGCCGAATCTGACCGTGAGCTGGGATCCGCGCATTAGTAGCGAACAGGATTATACCTGTATTGCAGAAAATGCAGTTAGTAATCTGAGCTTCAGCGTTAGTGCACAGAAACTGTGTGAAGATGTTAAAATTCAGTACACCGATACCAAAATG

Restriction Sites: NdeI-XhoI

Background: SLAMF6 (CD352/NTB-A) is a type-I transmembrane glycoprotein belonging to the signaling lymphocytic activation molecule (SLAM) family of immunomodulatory receptors. Like other members of the SLAM receptor family, SLAMF6 contains Ig-like domains within its extracellular region and conserved tyrosine-based signaling motifs within its intracellular domain that, when phosphorylated, bind to the SAP and EAT-2 signaling adaptors. SLAMF6 is expressed on the surface of multiple types of immune cells, such as those of the B, T, and NK lineages. Its activation is triggered by homotypic interactions involving its extracellular domain. Indeed, research studies have shown that in T-cells, SLAMF6 engagement facilitates activation and cytokine production. Similarly, homotypic ligand-mediated engagement of SLAMF6 on NK cells activates signaling cascades that drive proliferation, cytotoxicity, and cytokine production.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~25kDa

Notes: For research use only, not for use in diagnostic procedure.

CD352 Recombinant Protein - NCP0302

Item no : 31662673696
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches