CD360 Recombinant Protein

Catalogue Number: NCP0308-500, NCP0308-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q9HBE5

Host: E.coli

Tag: His-tag

AA Sequence: TGTCCGGATCTGGTGTGTTATACCGATTATCTGCAGACCGTTATCTGTATTCTGGAAATGTGGAATCTGCATCCGAGTACCCTGACCCTGACCTGGCAGGATCAGTATGAAGAACTGAAAGATGAAGCCACCAGCTGTAGTCTGCATCGCAGCGCACATAATGCCACCCATGCCACCTATACCTGTCACATGGATGTGTTCCACTTCATGGCCGATGATATCTTCAGCGTGAATATTACCGATCAGAGCGGCAATTATAGTCAGGAATGCGGTAGCTTCCTGCTGGCAGAAAGTATTAAACCGGCACCGCCGTTCAATGTGACCGTGACCTTCAGCGGTCAGTATAATATTAGCTGGCGCAGTGATTATGAAGATCCGGCCTTCTATATGCTGAAAGGCAAACTGCAGTATGAACTGCAGTATCGTAATCGCGGCGATCCGTGGGCAGTTAGCCCGCGTCGTAAACTGATTAGCGTTGATAGCCGTAGTGTGAGTCTGCTGCCGCTGGAATTCCGTAAAGATAGCAGCTATGAACTGCAAGTTCGCGCCGGCCCGATGCCGGGTAGCTCATATCAGGGCACCTGGAGCGAATGGAGTGATCCGGTTATCTTCCAGACCCAGAGTGAAGAACTGAAGGAA

Restriction Sites: NdeI-XhoI

Background: The IL-21 receptor (also designated IL-21R, NILR or novel interleukin receptor) is a type I cytokine receptor that forms a complex with the cytokine receptor γ chain, γc and mediates IL-21 signaling. IL-21R is present on the surface of natural killer, B and T cell populations with high levels in spleen and thymus. IL-21 and IL-21R influence lymphoid proliferation and early lymphoid development in the transition between innate and adaptive immunity. Tumor necrosis factor (TNF) upregulates IL-21R, and combinations of TNF and IL-21 can have synergistic effects on myeloma cell proliferation through pathways involving phosphorylation of JAK1, Stat3 and Erk1/2. The human IL-21R gene maps to chromosome 16p12.1 and encodes a 538 amino acid protein that is closely related to human IL2RB and shares 62% sequence identity to mouse Il21r.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~31kDa

Notes: For research use only, not for use in diagnostic procedure.