20% OFF shipping at www.randa.lt on orders over $79 + up to 10% OFF products
www.randa.lt
home > CD171/N-CAML1 Recombinant Protein - NCP0182 > CD171/N-CAML1 Recombinant Protein - NCP0182
download picture
CD171/N-CAML1 Recombinant Protein - NCP0182CD171 N CAML1 Recombinant Protein Catalogue Number: NCP0182 500, NCP0182 1000 Sizes: 500ug, 1mg Swiss Prot: P32004 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD171/N-CAML1 Recombinant Protein

Catalogue Number: NCP0182-500, NCP0182-1000

Sizes: 500ug, 1mg

Swiss-Prot: P32004

Host: E.coli

Tag: His-tag

AA Sequence: CAGGGTAAAGGCCCGGAACCGCAGGTGACCATTGGTTATAGCGGTGAAGATTATCCGCAGGCAATTCCGGAACTGGAAGGTATTGAAATTCTGAATAGCAGTGCCGTGCTGGTTAAATGGCGCCCGGTGGATCTGGCCCAGGTGAAAGGTCATCTGCGCGGTTATAATGTTACCTATTGGCGTGAAGGTAGCCAGCGTAAACATAGCAAACGTCATATTCATAAAGACCATGTGGTTGTGCCGGCCAATACCACCAGCGTGATTCTGAGCGGTCTGCGTCCGTATAGCAGTTATCATCTGGAAGTTCAGGCCTTCAATGGCCGCGGCAGCGGCCCTGCTAGTGAATTCACCTTCAGCACCCCGGAAGGTGTTCCGGGCCATCCGGAAGCACTGCATCTGGAATGCCAGAGTAATACCAGTCTGCTGCTGCGTTGGCAGCCGCCGCTGAGTCATAATGGCGTTCTGACCGGTTATGTGCTGAGCTATCATCCGCTGGATGAAGGTGGCAAAGGTCAGCTGAGCTTCAATCTGCGCGATCCGGAACTGCGTACCCATAATCTGACCGATCTGAGTCCGCATCTGCGCTATCGCTTCCAGCTGCAGGCAACCACCAAAGAAGGCCCGGGTGAAGCCATTGTGCGCGAAGGTGGTACCATGGCACTGAGTGGTATTAGTGACTTCGGCAATATTAGTGCCACCGCAGGTGAAAATTATAGTGTTGTGAGTTGGGTGCCGAAAGAAGGTCAGTGTAACTTCCGCTTCCATATTCTGTTCAAAGCACTGGGCGAAGAAAAAGGCGGCGCCAGCCTGAGTCCGCAGTATGTGAGTTATAATCAGAGTAGTTATACCCAGTGGGATCTGCAGCCGGATACCGATTATGAAATTCATCTGTTCAAAGAACGCATGTTCCGCCATCAGATGGCCGTGAAAACCAATGGCACCGGTCGTGTTCGTCTGCCGCCGGCAGGCTTCGCAACCGAA

Restriction Sites: NdeI-XhoI

Background: Neural cell adhesion molecule L1 (NCAM-L1/L1CAM) is a single pass transmembrane glycoprotein member of the immunoglobulin superfamily, containing six amino-terminal extracellular Ig-like domains followed by five fibronectin type-III domains. NCAM-L1 is mainly expressed in the brain, and plays an important role in the developing nervous system, with involvement in neurite fasciculation and outgrowth, myelination, neuronal migration, and neuronal cell adhesion. Mutations in the NCAM-L1 gene cause varying degrees of neurological disease including X-linked hydrocephalus, MASA syndrome, spastic paraplegia type 1, and X-linked corpus callosum agenesis, together known as L1 syndrome. Apart from the nervous system, NCAM-L1 is overexpressed in many cancers and supports a poor prognosis by facilitating aggressive tumor growth, metastasis and chemoresistance.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~36kDa

Notes: For research use only, not for use in diagnostic procedure.

CD171/N-CAML1 Recombinant Protein - NCP0182

Item no : 8942262296
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches